Appendix A
Site-saturation Mutagenesis of M121 of Pseudomonas aeruginosa Azurin

The original thesis contained a reprint of Chang et al 1991. This paper may be obtained from the PNAS web site. Abstract
PDF reprint of paper

Selected M121 mutants in the pET9a expression system.

The site-saturation mutagenesis of the azurin Cu ligand M121 described in the previous paper was carried out using cassette mutagenesis on the synthetic azurin gene cloned into pUC18. Subsequent to this work, a better expression system for azurin was developed in this lab (Germanas et al. 1993). Rather than transfer all the previously constructed M121 mutants into the pET expression system, representative mutants at M121 have been constructed directly from the wild type azurin cloned into pET9a using PCR mutagenesis.

The sense-strand primer spans the upstream Nde I restriction enzyme site. (See figure 1.) The anti-sense primer starts downstream of the azurin gene and contains two mutations, one to give the desired amino acid at position 121 and one to restore the Bgl II restriction enzyme site that is lost upon ligation to the compatible Bam HI overhang from the pET9a vector. Bam HI cannot be used to clone azurin into pET9a because our synthetic gene contains an internal Bam HI site.

The PCR reactions contained BMB buffer, dNTP's (0.2 mM each), 5 units Taq polymerase, 0.35 g template DNA, and 250 pmoles of each primer in a total volume of 100 l. Reaction mixtures overlaid with mineral oil were placed in a Perkin-Elmer DNA Thermal Cycler 480. Templates were denatured at 96C for 5 minutes followed by 30 PCR cycles denaturing at 96C for 30 seconds, annealing at 55C for 30 seconds, and polymerizing at 72C for 1 minute. Final polymerization was given 5 minutes at 72C. The PCR products were extracted from the reaction mix using 15 l Qiaex II resin according to the manufacturer's instructions (Qiaex II Gel Extraction Kit, Qiagen, Chatsworth, CA). The DNA was eluted with 20 l water and digested with Nde I and Bgl II in BMB buffer H (50 mM Tris HCl, 10 mM MgCl2, 100 mM NaCl, 1 mM dithioerythritol - final concentrations). The vector, pET9a/bla (pET9a containing the b-lactamase gene, a kind gift from Dr. Claire Slutter), was digested with Nde I and Bam HI in New England Biolabs (Beverly, MA) Bam HI buffer. Digests were purified on a 1.2% low melting point agarose gel; the bands were cut out and the agarose removed by overnight digestion with 1 unit of Gelase (Epicenter Technologies, Madison WI) followed by ethanol precipitation and resuspension in 20 l water. Ligations contained 1x NEB ligation buffer, 50 units ligase (New England Biolabs Beverly, MA), an estimated 1.5 g pET9a vector DNA, and the PCR products. After 21 hours at 16C, 1 l of each ligation was transformed into 20 l of competent BL21(DE3) cells (Novagen, Madison, WI).

Initial screening of transformed colonies was done by PCR, starting with 5 l of cells suspended in 50 l water. PCR was performed as above in a final reaction volume of 25 l using the T7 promoter and terminator primers and 0.125 units of Taq polymerase per reaction. After 55 cycles, the results were assessed on a 1.2% agarose gel. Qiagen Plasmid Maxipreps were done on colonies with inserts of the correct size, starting with 100 ml cultures of cells grown overnight in LB with 35 g/ml kanamycin. After isopropanol precipitation, the DNA was resuspended in 100 l water (average yields: 100 l at 4.2 g/l). The identities of the mutants were confirmed by dye-terminated cycle sequencing with the T7 promoter and terminator primers at the Beckman Institute DNA Sequencing Facility.

Reference: Germanas, J. P., Di Bilio, A. J., Gray, H. B. and Richards, J. H. (1993). Site saturation of the histidine-46 position in Pseudomonas aeruginosa azurin: Characterization of the His46Asp copper and cobalt proteins. Biochem. 32: 7698-7702.

Figure A.1 Oligonucleotides for selected M121 mutants in pET9a. Restriction enzyme recognition sites are underlined; mutations at position 121 are in boldface.

Azfront.s

CTT TAA GAA GGA GAT ATA CAT ATG CTG CG

 

M121G.as

GCA GCC AGA TCT CTA TTT CAG AGT CAG GGT ACC TTT ACC CAG T

M121K.as

GCA GCC AGA TCT CTA TTT CAG AGT CAG GGT ACC TTT TTT CAG T

M121D.as

GCA GCC AGA TCT CTA TTT CAG AGT CAG GGT ACC TTT ATC CAG T

M121L.as

GCA GCC AGA TCT CTA TTT CAG AGT CAG GGT ACC TTT CAG CAG T

 

 

Appendix B
Map and Gene Sequence of pET/ASA

Figure B.1 Azurin gene with some potentially useful (though not necessarily unique) restriction enzyme sites annotated. The junction between the signal sequence and the mature protein is shown. The metal ligands are indicated in the protein sequence by boldface type.


Nde I Pst I <- Signal sequence

ATGCTGCGTAAGCTGGCTGCAGTGTCTCTGCTGTCTCTGCTGTCTGCTCCGCTGCTGGCT

M L R K L A A V S L L S L L S A P L L A

Mature protein -> Bcl I

GCTGAATGCTCCGTTGATATCCAGGGTAATGATCAGATGCAGTTCAACACCAACGCCATC

A E C S V D I Q G N D Q M Q F N T N A I

Sal I Hpa I BstE II

ACCGTCGACAAGAGCTGCAAGCAGTTCACTGTTAACCTGTCTCACCCAGGTAACCTGCCG

T V D K S C K Q F T V N L S H P G N L P

Sac II

AAGAACGTTATGGGTCACAACTGGGTTCTGTCCACCGCGGCTGACATGCAAGGCGTTGTC

K N V M G H N W V L S T A A D M Q G V V

Nhe I Xho I

ACTGACGGTATGGCTAGCGGTCTGGATAAAGACTACCTGAAGCCGGATGACTCTCGAGTT

T D G M A S G L D K D Y L K P D D S R V

BamH I

ATCGCCCACACCAAGCTGATCGGATCCGGTGAAAAAGACTCCGTTACTTTCGACGTTTCC

I A H T K L I G S G E K D S V T F D V S

Hind III Xma I

AAGCTTAAAGAAGGTGAACAGTACATGTTCTTCTGCACTTTCCCGGGTCACTCCGCACTG

K L K E G E Q Y M F F C T F P G H S A L

KpnI

ATGAAAGGTACCCTGACTCTGAAATAG

M K G T L T L K End

 

Figure B.2 Map of the plasmid pET9A/ASA: the azurin gene, with signal sequence, cloned downstream of the T7 polymerase promotor in the expression vector pET9a. The origin of replication and kanamycin resistance gene are also shown. Recognition sites for restriction enzymes cutting only once in the plasmid are shown along the outside of the plasmid.

 

 

 

 

Appendix C
Map and Gene Sequence of pET/T9CuA

Figure C.1 DNA and protein sequences for the 'T9' soluble CuA domain from Thermus thermophilus. The valine following the initiating methionine is residue 44 in the sequence of the intact cytochrome c subunit II. The metal ligands, H117, C149, Q151, C153, H157, and M160, are in boldface. In the plasmids with surface histidines introduced by site-directed mutagenesis, the non-ligand, surface histidine H117 (underlined) was mutated to a glutamine residue. These plasmids differ from the original CuA fragment described by Slutter (Slutter 1996) by the introduction of a silent mutation at V132 (GTC -> GTT).

_____

Slutter, C. E. (1996). Overexpression and Characterization of the Copper A Domain from Cytochrome ba3 or Thermus thermophilus. Division of Chemistry and Chemical Engineering. Pasadena, California Institute of Technology.

 

ATGGTCATTCCCGCCGGAAAGCTTGAGCGCGTGGACCCCACCACGGTAAGGCAGGAAGGC

M V I P A G K L E R V D P T T V R Q E G

CCCTGGGCCGACCCGGCCCAAGCGGTGGTGCAGACCGGCCCCAACCAGTACACGGTCTAC

P W A D P A Q A V V Q T G P N Q Y T V Y

GTCCTGGCCTTCGCCTTCGGCTACCAGCCGAACCCCATTGAGGTGCCCCAAGGGGCGGAG

V L A F A F G Y Q P N P I E V P Q G A E

ATCGTCTTCAAGATCACGAGCCCGGACGTGATCCACGGCTTTCACGTGGAGGGCACCAAC

I V F K I T S P D V I H G F H V E G T N

ATCAACGTGGAGGTGCTCCCGGGCGAGGTTTCCACCGTGCGCTACACCTTCAAAAGGCCC

I N V E V L P G E V S T V R Y T F K R P

GGGGAGTACCGCATCATCTGCAACCAGTACTGCGGCCTAGGCCACCAGAACATGTTCGGC

G E Y R I I C N Q Y C G L G H Q N M F G

ACGATCGTGGTGAAGGAGTGA

T I V V K E Stop

Figure C.2 Map of the plasmid pET9a/T9CuA: the 'T9' soluble CuA fragment from Thermus thermophilus cloned downstream of the T7 polymerase promoter in the expression vector pTE9a. The origin of replication and the kanamycin resistance gene are also shown. Recognition sites for restriction enzymes cutting only once in the plasmid are shown along the outside of the plasmid.